PUT-151a-Zea_mays-2383143613



Probe Details

  • Follow the link in the "Probe Set" column to access detailed annotation at PLEXdb (http://www.plexdb.org)

  • Follow the link in the "Other Matches" column to access contig assembly information

";
Probe SetProbeOrientation Matching Position
(from - to)
Probe SequenceOther Matches (Sequence Length)
Zm.1000.1.A1_at Zm.1000.1.A1_at:705:129 + 1500 - 1524 ACGTGCAACCGTCGCCATGTGCGGAPUT-8-171a-Zea_mays-3893_(1734)
PUT-163a-Zea_mays-81773_(102)
PUT-163a-Zea_mays-159031_(163)
PUT-163a-Zea_mays-146704_(317)
PUT-163a-Zea_mays-101357_(203)
PUT-163a-Zea_mays-095344_(404)
PUT-157a-Zea_mays-79248_(317)
PUT-157a-Zea_mays-2753255031_(641)
PUT-157a-Zea_mays-2750255027_(1753)
PUT-157a-Zea_mays-119281_(163)
PUT-157a-Zea_mays-106484_(203)
PUT-157a-Zea_mays-054946_(404)
PUT-153a-Zea_mays-936155946_(1753)
PUT-153a-Zea_mays-45406_(404)
PUT-151a-Zea_mays-60341_(354)
PUT-151a-Zea_mays-2383143613_(1753)
PLEXdb.Zm.1000_(1271)
Zm.1000.1.A1_at:522:33 + 1516 - 1540 ATGTGCGGAGCTGGCTAGTACGTCC
Zm.1000.1.A1_at:624:469 + 1554 - 1578 GTACCTGAATCAGTTTTTCCGCCTC
Zm.1000.1.A1_at:681:623 + 1571 - 1595 TCCGCCTCCTATAGCAGCAATAAAG
Zm.1000.1.A1_at:324:659 + 1591 - 1615 TAAAGACGTCAGCATTTCTCCATTT
Zm.1000.1.A1_at:624:15 + 1604 - 1628 ATTTCTCCATTTTGTTCATCACCTA
Zm.1000.1.A1_at:69:659 + 1627 - 1651 TACAGGGCCCTTTGTTTCTTTGGCA
Zm.1000.1.A1_at:530:709 + 1642 - 1666 TTCTTTGGCAAACTCTTCTGCGATT
Zm.1000.1.A1_at:651:635 + 1658 - 1682 TCTGCGATTCAGCTGTCACTGTTGA
Zm.1000.1.A1_at:429:477 + 1672 - 1696 GTCACTGTTGAATTCTGCTGTTGGC
Zm.1000.1.A1_at:449:535 + 1700 - 1724 GGATAATCTATTTTTACCAGCAGCC
Zm.1000.1.A1_at:90:337 + 1386 - 1410 GCATCAGGGACTCGGTCTTCAGTAA
Zm.1000.1.A1_at:294:641 + 1401 - 1425 TCTTCAGTAACATTTGCCTCTCCAA
Zm.1000.1.A1_at:502:615 + 1415 - 1439 TGCCTCTCCAACGTGAAGCTCTATG
Zm.1000.1.A1_at:692:109 + 1431 - 1455 AGCTCTATGGCATTGGCAGCGACTC
MZ00018754 MZ00018754 + 1522 - 1591 GGAGCTGGCTAGTACGTCCGGGACAGGTTTCTGTACCTGAATCAGTTTTTCCGCCTCCTATAGCAGCAATPUT-8-171a-Zea_mays-3893_(1734)
PUT-157a-Zea_mays-2753255031_(641)
PUT-157a-Zea_mays-2750255027_(1753)
PUT-153a-Zea_mays-936155946_(1753)
PUT-151a-Zea_mays-2383143613_(1753)

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!