Barley1_01648
Probe Details
- Follow the link in the "Probe Set" column to access detailed annotation at PLEXdb (http://www.plexdb.org)
- Follow the link in the "Other Matches" column to access contig assembly information
";
| Probe Set | Probe | Orientation | Matching Position (from - to) |
Probe Sequence | Other Matches (Sequence Length) |
|---|---|---|---|---|---|
| Contig1648_at | Contig1648_at_814 | + | 802 - 826 | TGGGAGTTCCAAGTCGGCCCTTCCG | PUT-161a-Hordeum_vulgare-903109812_(1653) PUT-161a-Hordeum_vulgare-83430_(433) PUT-161a-Hordeum_vulgare-83373_(983) PUT-157a-Hordeum_vulgare-909111102_(1653) PUT-157a-Hordeum_vulgare-78098_(433) PUT-157a-Hordeum_vulgare-78046_(983) PUT-155a-Hordeum_vulgare-927110927_(1653) PUT-155a-Hordeum_vulgare-76001_(433) PUT-155a-Hordeum_vulgare-75946_(983) PUT-154a-Hordeum_vulgare-888110924_(1653) PUT-154a-Hordeum_vulgare-14042_(433) PUT-154a-Hordeum_vulgare-13955_(983) PUT-151a-Hordeum_vulgare-14664_(433) PUT-151a-Hordeum_vulgare-14560_(983) PUT-151a-Hordeum_vulgare-14558_(1653) Barley1_01648_(1421) |
| Contig1648_at_868 | + | 856 - 880 | GCGGCTCGCTACATTCTCGAGAGGA | ||
| Contig1648_at_888 | + | 876 - 900 | GAGGATCACTGAGATCGCCGGCGTC | ||
| Contig1648_at_956 | + | 944 - 968 | GTGCCGGTGCCCACACAAACTACAG | ||
| Contig1648_at_976 | + | 964 - 988 | TACAGCACCAAGTCGATGAGGAGCG | ||
| Contig1648_at_1030 | + | 1018 - 1042 | ATCAAGAAGCTCGAGGCGCGGCACA | ||
| Contig1648_at_1049 | + | 1037 - 1061 | GGCACACGGAGCACATAGCCGCCTA | ||
| Contig1648_at_1268 | + | 1256 - 1280 | AGACCACCATCCTCTGGAAGGCCGG | ||
| Contig1648_at_1288 | + | 1276 - 1300 | GCCGGTCTCTCCAATGGCAAGTAGA | ||
| Contig1648_at_1323 | + | 1311 - 1335 | ATGGTGTTATGTGTAAGCGCCCCGT | ||
| Contig1648_at_1352 | + | 1340 - 1364 | GTGTGTGCGTGATCTGCATTGCAGT |