Barley1_00079
Probe Details
- Follow the link in the "Probe Set" column to access detailed annotation at PLEXdb (http://www.plexdb.org)
- Follow the link in the "Other Matches" column to access contig assembly information
";
| Probe Set | Probe | Orientation | Matching Position (from - to) |
Probe Sequence | Other Matches (Sequence Length) |
|---|---|---|---|---|---|
| Contig79_at | Contig79_at_445 | + | 433 - 457 | ACGTGCTGAGCGGACTGGTGCACCT | PUT-161a-Hordeum_vulgare-496109809_(845) PUT-161a-Hordeum_vulgare-496109808_(947) PUT-157a-Hordeum_vulgare-600111104_(845) PUT-157a-Hordeum_vulgare-600111103_(947) PUT-155a-Hordeum_vulgare-606110927_(845) PUT-155a-Hordeum_vulgare-606110926_(947) PUT-154a-Hordeum_vulgare-593110920_(845) PUT-154a-Hordeum_vulgare-592110929_(947) PUT-151a-Hordeum_vulgare-301106207_(947) PUT-151a-Hordeum_vulgare-301106206_(659) PUT-151a-Hordeum_vulgare-102916_(657) Barley1_00079_(999) |
| Contig79_at_562 | + | 550 - 574 | GGGCGCGGGTCCTCAACATCAACAT | ||
| Contig79_at_576 | + | 564 - 588 | AACATCAACATCTACCTCCCGGTGG | ||
| Contig79_at_711 | + | 699 - 723 | TCGCCATAGCTTTACTACCATACTA | ||
| Contig79_at_724 | + | 712 - 736 | ACTACCATACTAGCGTGTGGCGTGG | ||
| Contig79_at_749 | + | 737 - 761 | GGTGCTACAGTGCTTGCTCGCTCCA | ||
| Contig79_at_780 | + | 768 - 792 | TGCGTGCCTGCGATTTGTGTGCGTC | ||
| Contig79_at_802 | + | 790 - 814 | GTCTCGATCGACCTCGACCGATTTT | ||
| Contig79_at_817 | + | 805 - 829 | GACCGATTTTCTTGTTCCGTGTTAG | ||
| Contig79_at_853 | + | 841 - 865 | AGTGTGGCAACTCCATGTGGTTTCC | ||
| Contig79_at_870 | + | 858 - 882 | TGGTTTCCGGCCAAGTGATGTTGAA |