Barley1_00076
Probe Details
- Follow the link in the "Probe Set" column to access detailed annotation at PLEXdb (http://www.plexdb.org)
- Follow the link in the "Other Matches" column to access contig assembly information
";
| Probe Set | Probe | Orientation | Matching Position (from - to) |
Probe Sequence | Other Matches (Sequence Length) |
|---|---|---|---|---|---|
| Contig76_at | Contig76_at_67 | + | 55 - 79 | TCAAAAGCTCCGTCTGTCAGCAATG | PUT-161a-Hordeum_vulgare-56604_(655) PUT-161a-Hordeum_vulgare-52050_(686) PUT-157a-Hordeum_vulgare-82675_(686) PUT-157a-Hordeum_vulgare-54059_(655) PUT-155a-Hordeum_vulgare-52863_(655) PUT-155a-Hordeum_vulgare-33296_(686) PUT-154a-Hordeum_vulgare-47499_(655) PUT-154a-Hordeum_vulgare-34381_(686) PUT-151a-Hordeum_vulgare-50192_(655) PUT-151a-Hordeum_vulgare-45176_(681) Barley1_00076_(681) |
| Contig76_at_76 | + | 64 - 88 | CCGTCTGTCAGCAATGGAGGTTTCA | ||
| Contig76_at_85 | + | 73 - 97 | AGCAATGGAGGTTTCAGGCGCTGCA | ||
| Contig76_at_545 | + | 533 - 557 | GCCACCAAGGCTTAGGAACACGCAT | ||
| Contig76_at_553 | + | 541 - 565 | GGCTTAGGAACACGCATAGGTTGAT | ||
| Contig76_at_560 | + | 548 - 572 | GAACACGCATAGGTTGATGTAGGTT | ||
| Contig76_at_575 | + | 563 - 587 | GATGTAGGTTGCTTAATGTCTGTAA | ||
| Contig76_at_590 | + | 578 - 602 | ATGTCTGTAACATTGGTCGTTGTTT | ||
| Contig76_at_603 | + | 591 - 615 | TGGTCGTTGTTTGGCTAATGGTGTC | ||
| Contig76_at_614 | + | 602 - 626 | TGGCTAATGGTGTCGATGTAATCTT | ||
| Contig76_at_622 | + | 610 - 634 | GGTGTCGATGTAATCTTTGCTGTTA |