DS LOGO

I.S08.1008 (Ds Insertion Line)    View RefGen_v1 Placement     Admin

Jump to Record:



diagram of ds insertion

Predicted Ds insertion site / closest B73 gene for I.S08.1008       Order Seed    View all Ds Insertions

Alt
Loc
Predicted Ds insertion site   Closest Maize Gene
GDB Ds Distance from Gene All Ds
near
gene
Flanking sequence (fDs)
Quality
Score
Seq
Pos
1 5: 2,339,291 GRMZM2G144172_T01
[View Locus Details]
0.7 kb from 5` end gi|327475427 (I.S08.1008_JSR05) HQ 3a
1 5: 2,339,291 GRMZM2G144172_T01
[View Locus Details]
0.7 kb from 5` end gi|327475428 (I.S08.1008_JSR04_JSR05_dir) MQ3 3d

Placement Details

More on Insertion Site...


Redundancy Group: RS.0183

More on redundancy...

This seedstock is available from the Maize Genetics Coop as AcDs-00353

To request seed of I.S08.1008 (AcDs-00353), you can add it to a Maize Coop Stock Center order -- this action takes you to the maizegdb.org website. Then complete the order on maizegdb, or use the "back" button to return to PlantGDB and additional searches. Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order (see below).

Before You Order...


Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 327475427 (I.S08.1008_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|327475427 (651 bp)

>gi|327475427|gb|HR872237|I.S08.1008
CACTTGTGCATGGCATGGCCTGGCCATGGCCGGGCGCGTATCTGACGAAACTGATCGACGTCGTCCGCGTTTCACAGTTTGCGTTGTCGAAATAGACGAA
TTAATTGACAAGTGCACCTGCAGCAGTACTTGTAGTGGAGAGAGCAAGGTAGGAGCAAGATCAGAGAAACGAAGCCTCGTGCTCCCAACTATACCTCGAC
CACGCTAGCTGGTCGTCGATCGATCGATCGAGATCTACGACGACGCTGGACATCAGATTCTTGGGCACGTACGCACGCATTGGGATCGGATCTCTGCGTG
CATAGTAGATGCCGGCCACATCAAAGCTAGCACTAGCTAGCTAGCTCATTACTAGTCATTAACATACCATTTCGAACATGCGCATTATATTCCTTGGAGT
CTTGTCCAGAATAAAAACGAGTATATATATATACGCACGTCATGTCGGAAGGAGTAGTTTATAGTGCATGCTGGTATATATGTAGTACTAGCACGAAAGC
AGGGTGTATTCTGTGCGTGCGAGGGGAATGTCGTCGCTAGATCTCAAGGTAATTAATATTGCATGTATCGTCTATGCATGGCCTCCGATCCTGGTCCATG
CATGATTGTTTTCGCGCATGTGATGCAACGTGTGTGAAGGCAAAAGCTCAA

3' Distal fDs: 327475428 (I.S08.1008_JSR04_JSR05_dir) Blast@ZmGDB

Show FASTA Sequence for gi|327475428 (392 bp)

>gi|327475428|gb|HR872238|I.S08.1008
CCGCGGTGATGGCCGTTGGGNCCTTTTCGTTTACNTCAATTACGCCAGAAGCGCCAGCCGTCGGTCGGAACTTGGCAAGGATCGAGCAGCCAGTGCAAAG
CACTAGCTTAGCAGCTTGTGTTGTACCTGAACGCATGCAGCAACGAGAAAAAGAGAGAGAGAAAGAGAGATGCNTCAGCATGGAATGGTAGCCCAGCAGC
AGCCAGGACGACAGNNGGTGGTCGGAGGGTATCAGATTCNTGTCAGATCNACTTGTACTGGAAATCACACGCATATAGGCATAGAGCGAGGGGATCACGA
AAAATGACAGCTTTAGCTTTATACACGTACAACCGCAGCATGCAGCTGCTGGAGGCCCCCCCCACACNTTTTCCCCNTTTGGAGGTCCTTAC



Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 3 kb.
Southern Notes:


Inverse PCR

Genomic DNA digestion performed using the restriction enzyme SacII.
Predicted to produce a kb band using primers LC24 LC18.
IPCR Notes:

Product was used in PCR again using primers JSR01 LC18, producing a 2.1 kb band.


Sequencing

IPCR product was processed by EtOH precipitation.
Sequencing reaction was performed using primers and .
Sequencing Notes:

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!