DS LOGO

I.S07.4268 (Ds Insertion Line)    View RefGen_v1 Placement     Admin

Jump to Record:



diagram of ds insertion

Predicted Ds insertion site / closest B73 gene for I.S07.4268       Order Seed    View all Ds Insertions

Alt
Loc
Predicted Ds insertion site   Closest Maize Gene
GDB Ds Distance from Gene All Ds
near
gene
Flanking sequence (fDs)
Quality
Score
Seq
Pos
1 7: 172,938,861 GRMZM2G166738_T01
[View Locus Details]
-1.1 kb from 5` end gi|226938799 (I.S07.4268_JSR03) HQ 5a
1 7: 172,939,016 GRMZM2G166738_T01
[View Locus Details]
-0.9 kb from 5` end gi|226938580 (I.S07.4268_JSR05) HQ 3a

Placement Details

More on Insertion Site...


This seedstock is available from the Ac/Ds Project

To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( I.S07.4268). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.

Before You Order...


Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

5' Adjacent fDs: 226938799 (I.S07.4268_JSR03) Blast@ZmGDB

Show FASTA Sequence for gi|226938799 (294 bp)

>gi|226938799|gb|FI849768|I.S07.4268
TCTCCCTGCTCCAAGGATCAGCATGAATGTGAGTTGATTTACAATCCGCACCATCCAGACTTGGCATCTTCTGTCACAGTCTGCGATCTCTGAATTCTGA
GTGCCATGTGCCCATGTTATCGTGTTCGCCGATCTCCATCACCTGACTGTTACCTTCACATGTTACCTAGCTACACTTAGCTTTCAGAAACATTTCATCA
TTTTAACCCTAACCCTGTAGAGAATTTCTTCCCTTCGCCAGATACCGTCATCCCGATAACCTGCGCCATACTGGTGTTCCTGTTCGCGCTGCAG

3' Adjacent fDs: 226938580 (I.S07.4268_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|226938580 (828 bp)

>gi|226938580|gb|FI849902|I.S07.4268
ATGCAGGTGCCGATCATGACCATGACGAGCAGCGCGGTGTGCAGCCTCGTGTGCTTCTCCAGCCACGCCCTGAGCAGGCCGGACCTCCCGGCGGCCTCGC
GCGGGCGCTCCAGCCTGTAGGTGGAGAGCTCCTCGTCGGCGACCTGGCGGTTGGGGAGGAGGCTGACATTGGCGTGGCGGCAGATGAGGGAGTAGAGCGC
GAACGTGCCGCCTGCGCGGTGCCGGATCGGAGAGGTGGTGGTGGTGAGCGAGAAGAAGAAGAGGAGGAGTGGGGGGGCGCGGCGGTGCAAGGCAGACGCA
CGTACCCTCGCCGCTGTCGTCGGCGCGCAGGACGATGGTGGCGTACTTGAGGAGCGGGACGAGGGTGAGCGTCCAGAAGACGAAGGAGAGCGCGCCGAAG
ATCTCCTGGTTGGTCTCCGAGTGCGTGATGTCCTCGGCGAAGGTGCTCTTGTACACGTACAGCGGCGAGATGCTGAGGTCGCCGTACACCACCCCGAGGC
TCTGGTACGCCAGCAGCAGCGTCGTCCGCCACGCCCGCCGCCCCTGCACGCAGTCAATCAGAGCAGCAGCAGCGCCGGCGTTTCGGCAGCTGGAATCAAA
GAGCTCTGCGGTCTGAGCTGGATTTGGGAGCTGGGTCTGAGTCTGGCTGACCTTTTGTGGCGCCGTGCCGACGCCGAACTCGGGATCCATGGCTATGCTA
TGCGTTGTTGGTAGCCTAGCCTCTGTTCATGCGCACAACACGCATTGGGGGCAGGGCAGGGCAGGCGATGCGAGCAATGCCGTCTCCTCGTCCAGCCGGA
TTGAGCCTGGGCTTGGGGCAGCCTGCAG



Genetics

Line was produced using as a donor.
Ds element donor under selection for transpositions.
Identified as Southern band of 0 kb.
Southern Notes:


Inverse PCR

Genomic DNA digestion performed using the restriction enzyme .
Predicted to produce a 0 kb band using primers .
IPCR Notes:


Sequencing

IPCR product was processed by .
Sequencing reaction was performed using primers and .
Sequencing Notes:

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!