PlantGDB

Home

Ac/Ds Tagging

I.S07.3513 (Ds Insertion Line) View RefGen_v1 Placement Admin

Jump to Record:

Predicted Ds insertion site / closest B73 gene for I.S07.3513 Order Seed View all Ds Insertions

Alt Loc	Predicted Ds insertion site	Closest Maize Gene	GDB	Ds Distance from Gene	All Ds near gene	Flanking sequence (fDs)	Quality Score	Seq Pos
1	1: 5,434,973	GRMZM2G176558_T01 [View Locus Details]		-0.2 kb from 5` end		gi\|224517294 (I.S07.3513_JSR05)	MQ2	3a

Placement Details

Insertion site details for I.S07.3513

	fDs Placement				fDs Placement alternative (if any)
fDs sequence position -⟩
Sequence Type -⟩	5' Distal	5' Adjacent	3' Adjacent	3' Distal	5' Distal	5' Adjacent	3' Adjacent	3' Distal
fDs CloneID			I.S07.3513_JSR05
fDs gi			224517294
fDs Acc			FI599651
fDs Seq Length			788
Single/Dual Placement			SP
Placement Quality			MQ2
Likely Ds Insertion Site Click to view at ZmGDB			1: 5,434,973
Closest Gene (Click to view) Ds Distance (red=inside gene)			GRMZM2G176558_T01 (-0.2 kb from 5' end)
Gene BLASTp top hit Click to view UniRef record			filtered_set; syntelog; UniRef90: B6SVJ7_MAIZE Hemolysin n=1 (Zea mays) Exp=0; maizesequence.org: EntrezGene:100274981; hypothetical protein LOC100274...
BLAST fDs @ZmGDB (Zm-genome masked)			Blast@ZmGDB
Chr			1
fDs Left Coord			5,434,974
fDs Right Coord			5,435,770
fDs Orientation			+

Click for explanation of location, placement (SP, DP) and quality (HQ, MQ1, etc.)

Redundancy Group: RS.0138

This seedstock is available from the Ac/Ds Project

To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( I.S07.3513). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.

Before You Order...

Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 224517294 (I.S07.3513_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|224517294 (788 bp)

>gi|224517294|gb|FI599651|I.S07.3513
CCGCTCCCGCCCCTTCTACTTCTACCCCTCCCCCGCGGGCCGAGAGGGAGTCCGCCCGCCGGCGCCGCGCGACTCACCGATGCCCAGCCATGAGGCCTGC
TGCGGCACCATGTTCTGGGTGTACCTCATGTCCTGCGTCGGCCTCGTCGTCTTCGCCGGCCTCATGTCGGGCCTCACCCTCGGCCTCATGTCCCTCAGCC
TCGTCGACCTCGAGGTGCTCGCCAAGGCCGGCACGCCCAAGGACAAGCTCAACGCCGGTACTCCTCCTCCTCGTCTCTCCCGCGGCGGCGGCCGCATATT
GCCGCACCAGCTGCTGCTTATGGTTTACCGACTAACTAACCTGTGTCGTGCGTTGTCCTCGCCCCCGCAGCCAGGATCCTCCCCGTAATGAAGAACCAGC
ACCTGCTCCTCTGCACGCTCCTCATCGGAAACTCGCTCGCCATGGAGGCGCTGCCCATATTCCTCGACACGCTCGTGCCGCCCTACGTCGCCATCCTCAT
CTCCGTCACGCTCATCCTCGCGTTCGGGGAGGTGGGGCTGTCGTACCTCTACTGATCACTTCGATCGATCCAATGGAAATCAGTTTCCCCCCTTCCTGAC
GAATGAATTGATCCACCAGCTGATTCGGTTCCTCCTTCTGCTGTGCTACCTCCGCAGATCATGCCGCAAGCCATCTGCACGCGCTACGGGCTCAGCGTGG
GGGCCAAGGCGGCGCCCGTCGTCCGCCTACTGCTCATCCTCTTCTTCCCCGTCGCCTACCCGATCAGTAAGGTACGTTACGTGCGTGC

Genetics

Line was produced using a1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 3.3 kb.
Southern Notes:

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme PstI.
Predicted to produce a 2.4 kb band using primers LC24 LC18.
IPCR Notes:

Sequencing

IPCR product was processed by ethanol precipitation.
Sequencing reaction was performed using primers JSR05 and JSR03.
Sequencing Notes: