DS LOGO

I.S07.3023 (Ds Insertion Line)    View RefGen_v1 Placement     Admin

Jump to Record:



diagram of ds insertion

Predicted Ds insertion site / closest B73 gene for I.S07.3023       Order Seed    View all Ds Insertions

Alt
Loc
Predicted Ds insertion site   Closest Maize Gene
GDB Ds Distance from Gene All Ds
near
gene
Flanking sequence (fDs)
Quality
Score
Seq
Pos
1 7: 166,162,996 GRMZM2G079669_T01
[View Locus Details]
0.9 kb from 5` end gi|226938825 (I.S07.3023_JSR03) MQ3 5a
1 7: 166,162,938 GRMZM2G079669_T01
[View Locus Details]
1 kb from 5` end gi|226938605 (I.S07.3023_JSR05) HQ 3a

Placement Details

More on Insertion Site...


Redundancy Group: RS.0162

More on redundancy...

This seedstock is available from the Maize Genetics Coop as AcDs-00114

To request seed of I.S07.3023 (AcDs-00114), you can add it to a Maize Coop Stock Center order -- this action takes you to the maizegdb.org website. Then complete the order on maizegdb, or use the "back" button to return to PlantGDB and additional searches. Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order (see below).

Before You Order...


Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

5' Adjacent fDs: 226938825 (I.S07.3023_JSR03) Blast@ZmGDB

Show FASTA Sequence for gi|226938825 (509 bp)

>gi|226938825|gb|FI849794|I.S07.3023
GTCCAGGGGTGTACAGTATAGTAGGAGGCCAATCCTCCAACGAACCAAAGGCCTGTGTGTGTGTGTGCCCGTCGTCATGTACAGATGCCTCTGTTCTGCT
GCGCTTGCTCGCAACACAGGCTCACAGCTGCTGTGTGCTCCTGCTCCACAGCTTTACACGAGCTACGAGAGCTTGTTGCTGGCGCCTTGGAGAGTCGGAG
ACCGATGAAATAAAGGAACTGGTTACTTTTTTTTTTCTTGACGTGCCGAAAGGATCCAAAAAGCCAACCGCACGCTCCACTCGATCCAATCATACGGCGG
TAGCAGCGCGCGACGGGCAGTTTTCCACGCGCCCCTTCTTTGCTCGTCGCCTTTTCATGCACCGCAGCAGAGGTGCCAGCCCTGCCTGGCTGCTAGTGCT
AGGGCAGGCAGCAGGGCAAAAGTGTACTACGATATATTTTTATACATATACATAGAATTAAACCCGTATAGGATATGACGAACTGCTCGCTCCCCTGTGT
CCTCTGCAG

3' Adjacent fDs: 226938605 (I.S07.3023_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|226938605 (197 bp)

>gi|226938605|gb|FI849927|I.S07.3023
CCCTGGGACATCCGCATGACCCCATCTACTACGCATCGATAGCAGCGTGTGTAATGCAATGGGCTCACATGCAGCCATGCCATGTTAACCAGTAGGCCCA
CAGCACAGAGATCATTGCAGGTGTAAGTATAAGGCTGAGGACCCCCCAGAACTAATTGCAAGTAAAAAAAGCAGTTGTTGCCTCGCCGCGGCTGCAG



Genetics

Line was produced using a1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 2.9 kb.
Southern Notes:


Inverse PCR

Genomic DNA digestion performed using the restriction enzyme PstI.
Predicted to produce a 1.9 kb band using primers LC24 LC18.
IPCR Notes:


Sequencing

IPCR product was processed by precipitation.
Sequencing reaction was performed using primers JSR05 and JSR03.
Sequencing Notes:

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!