PlantGDB

Home

Ac/Ds Tagging

I.S07.1706 (Ds Insertion Line) View RefGen_v1 Placement Admin

Jump to Record:

Predicted Ds insertion site / closest B73 gene for I.S07.1706 Order Seed View all Ds Insertions

Alt Loc	Predicted Ds insertion site	Closest Maize Gene	GDB	Ds Distance from Gene	All Ds near gene	Flanking sequence (fDs)	Quality Score	Seq Pos
1	10: 130,907,058	GRMZM5G828581_T01 [View Locus Details]		-0.1 kb from 5` end		gi\|229620016 (I.S07.1706_JSR05)	HQ	3a

Placement Details

Insertion site details for I.S07.1706

	fDs Placement				fDs Placement alternative (if any)
fDs sequence position -⟩
Sequence Type -⟩	5' Distal	5' Adjacent	3' Adjacent	3' Distal	5' Distal	5' Adjacent	3' Adjacent	3' Distal
fDs CloneID			I.S07.1706_JSR05
fDs gi			229620016
fDs Acc			FI856494
fDs Seq Length			105
Single/Dual Placement			SP
Placement Quality			HQ
Likely Ds Insertion Site Click to view at ZmGDB			10: 130,907,058
Closest Gene (Click to view) Ds Distance (red=inside gene)			GRMZM5G828581_T01 (-0.1 kb from 5' end)
Gene BLASTp top hit Click to view UniRef record			filtered_set; syntelog; UniRef90: No significant hits (1e-5); maizesequence.org: UniGene:Zm.79705; Hypothetical protein LOC100193850...
BLAST fDs @ZmGDB (Zm-genome masked)			Blast@ZmGDB
Chr			10
fDs Left Coord			130,906,954
fDs Right Coord			130,907,057
fDs Orientation			-

Click for explanation of location, placement (SP, DP) and quality (HQ, MQ1, etc.)

This seedstock is available from the Ac/Ds Project

To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( I.S07.1706). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.

Before You Order...

Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 229620016 (I.S07.1706_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|229620016 (105 bp)

>gi|229620016|gb|FI856494|I.S07.1706
GCAGCAACCTCTTCCCCCGTTCCCTGCTCCTTCCTCTTCTCCAGGCTCCAAGAAGAGATAGACGGGGGAGAGAGACGGTGGTTTGTTCTCCTTGGAAGAG
AAAGA

Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 3 kb.
Southern Notes:

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme SacII.
Predicted to produce a 2 kb band using primers LC24 LC18.
IPCR Notes:

Product was used in PCR again using primers JGp2 LC45, producing a 2 kb band.

Sequencing

IPCR product was processed by gel extraction.
Sequencing reaction was performed using primers JSR05 and JSR04.
Sequencing Notes: JSR05 only