PlantGDB

Home

Ac/Ds Tagging

B.W07.0231 (Ds Insertion Line) View RefGen_v1 Placement Admin

Jump to Record:

Predicted Ds insertion site / closest B73 gene for B.W07.0231 Order Seed View all Ds Insertions

Alt Loc	Predicted Ds insertion site	Closest Maize Gene	GDB	Ds Distance from Gene	All Ds near gene	Flanking sequence (fDs)	Quality Score	Seq Pos
1	3: 165,178,054	GRMZM2G085113_T01 [View Locus Details]		0 kb from 5` end		gi\|229619971 (B.W07.0231_JSR05)	HQ	3a

Placement Details

Insertion site details for B.W07.0231

	fDs Placement				fDs Placement alternative (if any)
fDs sequence position -⟩
Sequence Type -⟩	5' Distal	5' Adjacent	3' Adjacent	3' Distal	5' Distal	5' Adjacent	3' Adjacent	3' Distal
fDs CloneID			B.W07.0231_JSR05
fDs gi			229619971
fDs Acc			FI856449
fDs Seq Length			569
Single/Dual Placement			SP
Placement Quality			HQ
Likely Ds Insertion Site Click to view at ZmGDB			3: 165,178,054
Closest Gene (Click to view) Ds Distance (red=inside gene)			GRMZM2G085113_T01 (0 kb from 5' end)
Gene BLASTp top hit Click to view UniRef record			filtered_set; syntelog; UniRef90: TE1_MAIZE Protein terminal ear1 n=1 (Zea mays) Exp=0; maizesequence.org: Uniprot/SWISSPROT:O65001; Protein terminal ...
BLAST fDs @ZmGDB (Zm-genome masked)			Blast@ZmGDB
Chr			3
fDs Left Coord			165,177,485
fDs Right Coord			165,178,053
fDs Orientation			-

Click for explanation of location, placement (SP, DP) and quality (HQ, MQ1, etc.)

This seedstock is available from the Maize Genetics Coop as AcDs-00167

To request seed of B.W07.0231 (AcDs-00167), you can add it to a Maize Coop Stock Center order -- this action takes you to the maizegdb.org website. Then complete the order on maizegdb, or use the "back" button to return to PlantGDB and additional searches. Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order (see below).

Before You Order...

Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 229619971 (B.W07.0231_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|229619971 (569 bp)

>gi|229619971|gb|FI856449|B.W07.0231
AGTGGAATGGGTGGGTTCCCGGAAGCCACGGGTAACCTTCTCGATGCCGCAGCTCAGGAGTTCCACCCTACGGTCTGTGCCCCCTATCCTCTACAGCCGC
TTCCGCAACAGCTATACTGCCCCCACCCATATCCAGCCATGCCGGTGCCTCCGCCGCCGCAAATAGCCATGTTACAGCCAGTGCCTCCGATGGCGATGGC
CATGGCGCCGCAGCCGGGGTACACCTTGCCAACGACGACGCCGGTGGTCAATGGCCCGTCGAGCCGCGTCGTGGTGCTGGGCCTTGTCCCGCCGCACGCG
CAGGAGGCCGACGTGGCGCAGGCGATGGCGCCATTCGGCGCGATCCGCTCGGTCGACGCGTGCGCGGTGGCGTCCGAGGGCGTGGCCACCGTCCATTTCT
TCGACATCCGCGCCGCCGAGCTCGCCTTGACCTGTGTCCGCGAGCAGCACATGCGCCAGCAGAGCCGCCTCGGGCAGCTCTACGCGGCGGCCGCCGTAGC
CCCGGCGTGGGCTCCTGCACCGACGCCCCAGGCCTGGGACTGGCCCCACCCCAACGACGACGGCCGCGG

Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 1.9 kb.
Southern Notes:

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme SacII.
Predicted to produce a 0.9 kb band using primers LC24 LC18.
IPCR Notes:

Product was used in PCR again using primers JGp2 LC45, producing a 0.9 kb band.

Sequencing

IPCR product was processed by gel extraction.
Sequencing reaction was performed using primers JSR05 and JSR04.
Sequencing Notes: none