DS LOGO

B.W06.1198 (Ds Insertion Line)    View RefGen_v1 Placement     Admin

Jump to Record:



diagram of ds insertion

Predicted Ds insertion site / closest B73 gene for B.W06.1198       Order Seed    View all Ds Insertions

Alt
Loc
Predicted Ds insertion site   Closest Maize Gene
GDB Ds Distance from Gene All Ds
near
gene
Flanking sequence (fDs)
Quality
Score
Seq
Pos
1 6: 113,674,070 AC202439.3_FGT006
[View Locus Details]
0.8 kb from 5` end gi|133823162 (B.W06.1198_JSR05) MQ3 3a
1 6: 113,674,070 AC202439.3_FGT006
[View Locus Details]
0.8 kb from 5` end gi|133823164 (B.W06.1198_JSR04_JSR05_dir) MQ4 3d

Placement Details

More on Insertion Site...


Redundancy Group: RS.0055

More on redundancy...

This seedstock is available from the Ac/Ds Project

To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( B.W06.1198). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.

Before You Order...


Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 133823162 (B.W06.1198_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|133823162 (659 bp)

>gi|133823162|gb|EI414145|B.W06.1198
CTCTCACCTTTGTGCCCGTCCTCTCGTTTTCTGCTCGCATGACGTCGTTCCCTTCCTGCAGGATCTATGAGAGTCGTTTTCGCGGCCTAGATAAGAAAGG
GTTCCTCCCCTCGAAAGACGTCTTCGAGTGGAGGCTAGAAGTCGAGGGCAAGGTGCCTCGTCGGGACGACGAAGTGGTCGTGCTCGCGTCCTTCTACAAA
CACGGGTTCGGGTTACCCCTTCATCTGTTCGTGTGGGGGCTCCTCCACTACTATTAGCTGGAGATCTAGAACCTCCAACCCAACGCGTCCTTCAAATAGC
GTGCTTCATCATGTTGTGTGAAGCGTTCATAGGGATCGATCCCCACCGGAGGATGTGGAAATACTTCTTCAATGCGCAGGTGTCCCCGGGTAGCGACGAT
CAACTATACGTCAGCTCGACCATCATTCAGCTCCGCTCTGGTCTGAAGGTGGAATACTTCTAGTTCCCTCTCCCTTCCTCCGTTCAATATGAAGGCGAGT
GGTTTTATGTGAGGAACGTGGCCGGGAGCGCCCCGCTATTCACTAGTCATGAGCCGGTGTCCTCGGATGAGTGGTAGCGCGGTGCATGGACGAGACTCAA
AACCGAAGTAGGAAACTTGCTGACGTCGGTCAAGACGCTGAAGCAGTGGGGGTCTCTCC

3' Distal fDs: 133823164 (B.W06.1198_JSR04_JSR05_dir) Blast@ZmGDB

Show FASTA Sequence for gi|133823164 (713 bp)

>gi|133823164|gb|EI414146|B.W06.1198
AGGAGGAGAGGAAGCAGAAGAGGGAGATGGGTGTAACATAACGGTTTTCATGACTATGCTCTATTTTTCTTCTTGCCTTCGGGCCTTAGAGGAAGATGCA
TGTTATTCCGTGGCTCAAATTTCGTTAGTGAGCGATGCCTGAGCCACTGGGGCATTTGCGCTTGTAGTACGATCAACTCCCTTGGGAAAGCCCTTTGTTC
GTGTCGCTGCCATCTAGTGCCTTTGGCAAGTGAAAACCATAAGTCTGTGTATCTTTGCCCTCTCGCGGGTGCCTGGTCGGATGAGCCTAGGTTTTGTTGT
CTTAGAATTGCCTTTTGGAGGTGCCACAGGAGGGGAGAGACACATGGAGGTTGCAGAACGTTGTAAACCAGATTTAAAAGTAGGAGTAACGTAGCTATTT
GGCGTTGGAGGCCACCGCACGCGAGTTGTTCAGACTCGGCTGGTCCCTTGTTTTGTAGGTACTGGGCACTTGCTTTGTTGCCATCTAGTGACTAGGGCAT
TTATGAGAAAAACAAAACTTAGTGCATCTAGGGATGGCCTGGCCATTCAGCCATCGTGTGACGATAGGGTCGAAAACTCGAGACATGCCTTATTGAGGGA
GGCCGTATCGTATGCACATCAGTGGGCCTGTGCACATATACTCATCTGTGATCGCAACCCTTCAATGTTGATCTGATGGCTACCACGATTTTTACACGGT
AATCCCCCCGCGG



Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 3 kb.
Southern Notes:

View Image: Southern Blot showing B.W06.1198
(Click image for larger version)

Southern Image

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme SacII.
Predicted to produce a 2 kb band using primers LC24 LC18.
IPCR Notes:

Product was used in PCR again using primers JGp2 LC45, producing a 2 kb band.


Sequencing

IPCR product was processed by gel purified-freeze dried.
Sequencing reaction was performed using primers JSR05 and JSR04.
Sequencing Notes: Coll. B.W06.1129B Two Reads

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!