DS LOGO

B.S05.0852 (Ds Insertion Line)    View RefGen_v1 Placement     Admin

Jump to Record:



diagram of ds insertion

Not Placed       Order Seed    View all Ds Insertions

   

Placement Details

More on Insertion Site...


This seedstock is available from the Ac/Ds Project

To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( B.S05.0852). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.

Before You Order...


Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

5' Adjacent fDs: 133822544 (B.S05.0852_JSR03) Blast@ZmGDB

Show FASTA Sequence for gi|133822544 (36 bp)

>gi|133822544|gb|EI413837|B.S05.0852
CCGGGGGTGTCCCGTCCGGCGTCCTATACCCAGCTG



Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 1.2 kb.
Southern Notes:

View Image: Southern Blot showing B.S05.0852
(Click image for larger version)

Southern Image

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme PvuII.
Predicted to produce a 0.2 kb band using primers LC24 LC18.
IPCR Notes:

Product was used in PCR again using primers JSR01 LC18, producing a 0.2 kb band.


Sequencing

IPCR product was processed by gel purified-freeze dried.
Sequencing reaction was performed using primers JSR03 and LC18.
Sequencing Notes: none

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!