DS LOGO

B.S05.0460 (Ds Insertion Line)    View RefGen_v1 Placement     Admin

Jump to Record:



diagram of ds insertion

Predicted Ds insertion site / closest B73 gene for B.S05.0460       Order Seed    View all Ds Insertions

Alt
Loc
Predicted Ds insertion site   Closest Maize Gene
GDB Ds Distance from Gene All Ds
near
gene
Flanking sequence (fDs)
Quality
Score
Seq
Pos
1 5: 215,301,845 GRMZM5G894016_T01
[View Locus Details]
-1 kb from 5` end gi|133821763 (B.S05.0460_Lc18_JSR01_dir) MQ2 5d
1 5: 215,301,845 GRMZM5G894016_T01
[View Locus Details]
-1 kb from 5` end gi|133821759 (B.S05.0460_JSR01) HQ 5a

Placement Details

More on Insertion Site...


This seedstock is available from the Ac/Ds Project

To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( B.S05.0460). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.

Before You Order...


Flanking genomic DNA sequence

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

5' Adjacent fDs: 133821759 (B.S05.0460_JSR01) Blast@ZmGDB

Show FASTA Sequence for gi|133821759 (610 bp)

>gi|133821759|gb|EI413741|B.S05.0460
CACCGGCGCCGTTCCATTCCAGCCATGGAGCTGCTCGCCCTGCTCACCGTGCTGCTGCTAGCGCACACCGCGGCATACCTGGCGTGGCAGGCCGTGTCAC
GCCGCCGCCGCGCGTGCTGCTACCTGCTGGACTACGCGTGCCACAAGCCCTCCGACGACCGCAAGGTGACCACCGAGACGGCGGGCGCCGTCATCGAGCG
CAACAAGCGGCTGGGCCTCTCCGAGTACCGCTTCCTCCTCAAGGTGATCGTCAACTCCGGCATCGGCGAGCACACCTACTGCCCGCGCAACGTGCTGCAG
GGCCGGGAGGAGAGCCCCACCCACGCCGACGCGCTGGAGGAGATGGACGAGTTCTTCGCCGACGCCGTGGCGGGGGTGCTCGGCAGGACGGGCGTGCGCG
CGCGCGACGTCGACCTGGTGGTCCTCAACGTGGGCTCCTTCTCCCCGGCGCCGTCCCTGGTGTCCAGGCTCGTGCGCCGCTTCGGCATGCGGGACGACGT
GATGGCGTACAACCTCTCCGGGATGGGCTGCAGCGCGGGGCTCGTCGCCGTGGACCTCGCGCGCGGCGTGATGCTGACGCGGCCGCGCACCATGGCGCTC
GTCGTCACCT

5' Distal fDs: 133821763 (B.S05.0460_Lc18_JSR01_dir) Blast@ZmGDB

Show FASTA Sequence for gi|133821763 (619 bp)

>gi|133821763|gb|EI413742|B.S05.0460
GCACCCTGTCCCCGCGCTTCAGCCTCCGCTTCGCCTCCATGTAGGAGAGCACGTACCAGAGGCTGCTCGCGGACGTGTTCCCCCACCGGTGCAGCGTCAT
CCTGGCCGGCTCCACGCCGTGGGCGGTGAGCCCCAGGCTCTTCCTGACCGCCTCGATCACCGCCGTCCCGCCGGGGTGGAGGCAGAAGTGGTCCACGCCG
GCCTTGAAGTCGATCTTGGGGCCGCCGCCGCCGGCGTGCTTGTTGCGCGGGGGGCCCGCCGGGACCGGGAGGAGCTTGCGGAGGAGGAGGCGGGACGCGA
AGCGCGCGAGCTCGCGGGCGGGCAGGATCCGCGGCGCCAGGCGCTGCAGGTTCTCGGTGAAGGCGCGCACGGCGGCCTTGGGCAGCGCCTTGCTGAGGCT
GACGCCGAGGCGGCCGTCGGCGTCCTCGCGGTGCACGGCGGCGGCGTGCGCGTCGTCGTGCGCGCCGATGTTGGCGCGCACGAGGCAGCGCAGCTCCATC
TTGGCGCGCGCCCGGAACGCCCGGTCGTTGGTCAGCAGCGCCGCGGCGCCGCCGCAGCGGAAGAGGCAGTTGCCGAGCATCATGGACTTGTCGGTGCCGA
CGTACCAGTTGGGCGCGCA



Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 2.4 kb.
Southern Notes:

View Image: Southern Blot showing B.S05.0460
(Click image for larger version)

Southern Image

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme PvuII.
Predicted to produce a 1.4 kb band using primers LC24 LC18.
IPCR Notes:


Sequencing

IPCR product was processed by Raw IPCR product.
Sequencing reaction was performed using primers JSR01 and LC18.
Sequencing Notes: Two Reads

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!