5', 3', Adjacent, Distal
Placement Scores:
Quality refers to the Megablast % identity/coverage score:
Alt refers to the alternate locations under DP:
To order seed, use the online order form . You will need a purchase order from your institution to complete the order. When ordering seed, use the 9-11 digit barcode as the unique identifier ( I.S06.1008). Please note that genomic location reported here is subject to error, so we advise you do careful research before placing your order.
See Possible v1 Insertion Site(s) above for potential Ds chromosomal location(s) based on one or more fDs sequences. Click the heading to view details including a link for running your own blastn analysis: Blast@ZmGDB. Please note that multiple, ambiguous placement locations are possible.
See also Redundancy Group--where multiple barcodes map to the same region; and Confirmation section-- if location has been confirmed by molecular methods. Other sections below give details on fDs Sequence, Genetics, PCR conditions and Sequencing Methods. Please contact us if you have any questions.
W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:
3' Adjacent fDs: 154359592 (I.S06.1008_JSR05) Blast@ZmGDB
>gi|154359592|gb|ER973849|I.S06.1008ACCGCCATCACGGAGGCCGACCTAAACAAGATTGAGCCATGGGACCTCCCTAGTACGTAACCAAAGCATCATTCTCGATCGCCTTGATATCCGTGCGTGCGTGCAGTGGATATATGCACGCTGCTATATATGCTGCCTATACCTGTCCTAGGCTAGTGATCGATCGAGATGTGGATTCAATTCAGTCGGTCGGTCGCATGCATGATGCAGGCAAGGCGAAGATGGGCGAGAAAGAGTGGTACTTCTTCTACCAGAAGGACCGCAAGTACCCGACGGGGCTGAGGGCGAACCGGGCCACCGAGGCCGGTTACTGGAAGGCGACGGGCAAGGACAAGGAGGTCTACAACGCCGCGG
Line was produced using r1 as a donor. Ds element donor under selection for unlinked transpositions. Identified as Southern band of 1.7 kb.Southern Notes:
Genomic DNA digestion performed using the restriction enzyme SacII. Predicted to produce a 0.7 kb band using primers LC24 LC18. IPCR Notes:
Product was used in PCR again using primers JGp2 LC45, producing a 0.8 kb band.
IPCR product was processed by ethanol precipitation. Sequencing reaction was performed using primers JSR05 and JSR04. Sequencing Notes: none