DS LOGO

B.S08.0183 (Ds Insertion Line)    Note: Outdated assembly! Go to RefGen_v2         Admin

Jump to Record:



Not Placed       Order Seed    View all Ds Insertions

   

(click for details)


How to request seedstock containing this insertion (click for details)


Flanking genomic DNA sequence

diagram of ds insertion

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 290792644 (B.S08.0183_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|290792644 (109 bp)

>gi|290792644|gb|GS923583|B.S08.0183
CCTCTACCACCGGCGCCGATTGCAGCACACCGTGTTGATGATGACGACATGGAGATGGAGCAGCAGCACCACCTGGTTGCTTCTGCCGCCAGCGGCGCTT
CTTCCGCGG



Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 1.4 kb.
Southern Notes:


Inverse PCR

Genomic DNA digestion performed using the restriction enzyme SacII.
Predicted to produce a 0 kb band using primers LC24 LC18.
IPCR Notes:

Product was used in PCR again using primers JSR01 LC18, producing a 0.4 kb band.


Sequencing

IPCR product was processed by gel extraction.
Sequencing reaction was performed using primers and .
Sequencing Notes:

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!