DS LOGO

B.S05.0006 (Ds Insertion Line)    Note: Outdated assembly! Go to RefGen_v2         Admin

Jump to Record:



Not Placed       Order Seed    View all Ds Insertions

   

(click for details)


How to request seedstock containing this insertion (click for details)


Flanking genomic DNA sequence

diagram of ds insertion

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

5' Adjacent fDs: 133821728 (B.S05.0006_TBp44) Blast@ZmGDB

Show FASTA Sequence for gi|133821728 (261 bp)

>gi|133821728|gb|EI413731|B.S05.0006
GAGGAGACCCTCTACGGCTCGTCCAGGCTCGCCGCCAGCGCCACCGCCACCGCCCGCGCCCTTATCTGAATTACTAGAATCCGGGCTCGTAGATGCTGGA
GTACACAGTACAGGGAAATTGCCCACTTTTTTCATCAACTTAAGTTTTTAGATTAAACTTTTTTGAAACAATCAGACAGGAGATCTGTCTTATATATTGA
TGAGGAGAAAGATGCCCAAAGGCAAAAAAAAAAGTCGATACAATAACAAGTCCATCAGCTG



Genetics

Line was produced using r1 as a donor.
Ds element donor under selection for unlinked transpositions.
Identified as Southern band of 1.3 kb.
Southern Notes:

View Image: Southern Blot showing B.S05.0006
(Click image for larger version)

Southern Image

Inverse PCR

Genomic DNA digestion performed using the restriction enzyme PvuII.
Predicted to produce a 0.3 kb band using primers LC24 LC18.
IPCR Notes:


Sequencing

IPCR product was processed by Raw IPCR product.
Sequencing reaction was performed using primers TBp44 and LC18.
Sequencing Notes: none

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!