DS LOGO

Ac.mon03068 (Ds Insertion Line)    Note: Outdated assembly! Go to RefGen_v2         Admin

Jump to Record:



Ds location and closest gene       Order Seed    View all Ds Insertions

Alt Est. Ds Insertion Site Closest Maize Gene
Ds Distance from Gene All Ds near gene Flanking sequence (fDs)
Sequence Type
1 Chr7:115,480,879 GRMZM2G099049_T01 128.6 kb from 3` end gi|70673332 (Ac.mon03068_JSR05) 3`Adj
(click for details)


How to request seedstock containing this insertion (click for details)


Flanking genomic DNA sequence

diagram of ds insertion

W22 flanking DNA sequence(s) (fDs) listed under Putative Location in B73 Genome (RefGen_v1) were derived from 5' or 3' end of Ds-containing fragment, using primers either adjacent (5a, 3a) or distal (5d, 3d) to the insertion site. Directionality is as shown in the diagram. For more information see AcDs Help. See below for FASTA sequence and BLAST links:

3' Adjacent fDs: 70673332 (Ac.mon03068_JSR05) Blast@ZmGDB

Show FASTA Sequence for gi|70673332 (1294 bp)

>gi|70673332|gb|AY618479|Ac.mon03068
TCAGCAGCAACGACCAAAAACTCCAAGCATCGCCTGGTGCAGCAGCTGCACACATCACGGCAAGGCTATCTATCAGATGGAGTAGGTAAAATAACTAAAT
CTGTCGCCCTCCACTTCACTCAGTAGGCGCAAGATTAGGARGGAAGCTTTGGGTGAAATGACGCATGGCTTATGATTTGTAAATGATTGTGTCAGGTGTG
CGCGGTTATTCTCGAGACCTTAGCATGTTTTTATTTTATTTTTTATCAATTGCATTGCAAAAAAAAAAAAATTTTGAAATCTTTAACGCGTTGGTCTTTT
CGGAACCATGCGAAAACTAGAGGTGGTCGCCAGGYGAAAACAGGTAGGTCGGGTATATCCGCCGAATACAGATAATATAAATACATATTTTCTTAGAGTT
AGATACGAATAATATAAATACCTAATGGTCGCCGTGTCATCGCAGTCCATAGCCGGCGGCCTTGGAAGTCCTGCGTATTGACATCTTTGCTGCTGGTTAT
TTAAAGTATCTTTTGCAATCCGTTACCTACCCCATGGAGTCATGAAACAGTACATAATTATATGACTAACTGTACGCCCAGTTCCTTCCATTTTCTTTTC
TTTTTTCCCGTTGAGCATGCCTAGTTATTTCCACTAGAAATTGATGGAAAACTGGAGGACCGAGGACAGCGAGCAAATACTGGGTGGAAGTGGAACCGAG
GCCGCTGGTCGCTGGATCGCAACGTCAGCCGTGGTTGGTAAACGTTGAGGTCATGACGGCAACACATAGTTTCCATCGTCTCAATGCAGCTGCCCGATCC
TCCTCCATCTGACACTGATACTTCCAAGTTGTGTAGTATATTTTTGCATCGTACCGTACCATGACCATACCACCTTGATTGCCGTTGTAACTAATGCGTC
CTTGAAGGATGCTGATGGATTAGTCCGTGAGACTGTACGTAGCAGATCATGTAAAATAGGGATTTGTTCTCTAAATTACAGGATTTATAGAGTGAAAATT
GAAATAGTGGATGTGATAAAGGAATRACATAGATACATGTTGAAGACAGTCTGACACTGCTTCTGCCAACGGTGGTGGGCCCATGCGGTCGCAAAAAAGA
CGAATGCAGCACGTCGATTAACCTTGATTGCAGCACGTCGATGCCATGGACCAGTCACCATTGCCACCGGGATCTACCTGCTTGACAACACGCGCGCCAC
AGGTGGGCAGATCGTCGATTAACCTATGCTTCTCAGGTCTAGCCGAGGGTAGAAATTCGTAGTAGCTTACAAATCACCTGCTTGGACTTTGCTC



Genetics

Line was produced using as a donor.
Ds element donor under selection for transpositions.
Identified as Southern band of kb.
Southern Notes:


Inverse PCR

Genomic DNA digestion performed using the restriction enzyme .
Predicted to produce a kb band using primers .
IPCR Notes:


Sequencing

IPCR product was processed by .
Sequencing reaction was performed using primers JSR05 and .
Sequencing Notes:

Loading Help Page...Thanks for your patience!

Loading Video...Thanks for your patience!

Loading Image...Thanks for your patience!