PlantGDB Pattern Search

Tools

Pattern Search

This specialized Vmatch server allows you to conduct pattern searches, i.e., searches for relatively short matches possibly interspersed with mismatches and indels. For example, if you designed a PCR primer (RT-PCR, or genomic PCR) to amplify your gene of interest, you may want to check if you primer sequences would likely cross-hybridize with other genes. You can use this tool to do just that. Upload your query sequence (pattern) file or paste your query sequence (pattern) into the large text field. Press the Search button to perform a search against the selected database sequences.

Step 1: Choose a database to match

Step 2: Select strand to find the match:

Step 3: Specify minium match length (default is 20; must be no less than 7):

Step 4: Define maxium match difference (mismatch/insertion/deletion):

Step 5: Paste query sequence (multiple sequences are allowed as sample input below) in FASTA format:

>ATcdna_test1 AAACCCTACCCTTCCTCGTTTCATCCGTACCATCATCAATCTTCTGATTCTCCATCATTAGACCAATCTG >ATcdna_test2 ATGGAATCTCTGAAACAAGCTTCTTCTGCTTCTGGGTTCTGCTACCACCAAGGCTTCTCAGGTGTTCTCC
Or upload query sequence(s) in FASTA format:

Last updated: June 28, 2007